10063   Taar1     Status: Germline transmission achieved

GeneTaar1
Chromosome10
Deletion Start23,640,195
Deletion End23,641,210
Deletion Size1,016
Genome Build37
MGI IDMGI:2148258
NCBI Gene ID111174
BAC ID215O19
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 10

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF23,640,40123,640,421ATGGCCATTGTCGACTTTCTG
TUP23,640,42323,640,447CTGCAGGGCATTATCAGACAGCCCA
TUR23,640,45623,640,475CCAACAGCGCTCAACAGTTC
TDF23,640,93823,640,957GAAACAAAAGCCGCGAAGAC
TDP23,640,95923,640,984AGGAAAACGCCCACCATGATCCCTAA
TDR23,640,98623,641,005AAGAACGGGCACCAGCATAC

PCR Primers

PrimerSequence
SUACTCTTCACCAAGAATGTGG
SDAAAAGATCATCTAAGGGCAG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev334 bp-++
TUFTUR75 bp++-
TDFTDR68 bp++-
NeoFwdSD556 bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
10063E-C9VGB6C57BL/6NTac
10063E-C11VGB6C57BL/6NTac
10063E-E4VGB6C57BL/6NTac
10063E-F5VGB6C57BL/6NTac
10063E-H9VGB6C57BL/6NTac