10169   Uap1l1     Status: ES cell colonies screened / QC positives

GeneUap1l1
Chromosome2
Deletion Start25,221,132
Deletion End25,217,145
Deletion Size3,988
Genome Build37
MGI IDMGI:2443318
NCBI Gene ID227620
BAC ID446L5
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 2

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF25,220,77525,220,796CCGGAAGAGTTAGAGCCTATGG
TUP25,220,72725,220,750CACTTCCCGAGTCCGTGTCCTCCA
TUR25,220,67725,220,701GGTTACTAGGCACAGGAGGAAGAAG
TDF25,217,66825,217,688GAGGTAGGTGCTGACCATTGC
TDP25,217,62925,217,651CCCAAATGGAGACCCTCCAGCCA
TDR25,217,60425,217,623GACACCAAGGGCGAGATCTC

PCR Primers

PrimerSequence
SUCAGAACAGTTTTATTCACGTG
SDTAGACAGACAATCAGAGTCC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev455 bp-++
TUFTUR120 bp++-
TDFTDR85 bp++-
NeoFwdSD253 bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
10169A-E7VGB6C57BL/6NTac
10169B-H7VGB6C57BL/6NTac
10169B-B7VGB6C57BL/6NTac