10173   1700029I15Rik     Status: Germline transmission achieved

Gene1700029I15Rik
Chromosome2
Deletion Start92,223,089
Deletion End92,223,743
Deletion Size655
Genome Build37
MGI IDMGI:1916742
NCBI Gene ID75641
BAC ID30I2
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 2

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF92,223,24192,223,262TGGAAGAGGCTGACCATTATCC
TUP92,223,27792,223,304TCATGAAGTCTTCACCCTGGACTGTCCC
TUR92,223,30692,223,326GGCCATTGCCACTTCTTTGTG
TDF92,223,31392,223,332AAGTGGCAATGGCCTTTTGG
TDP92,223,33492,223,361TTAGGGCTCAGCACAGCAATATTTCCCA
TDR92,223,37692,223,397GCTGAAAATTCCTCCGGAACAG

PCR Primers

PrimerSequence
SUGTAGTCTAGAGTGATGGACAG
SDAGACCCTGTTCTCATCTGTG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev333 bp-++
TUFTUR86 bp++-
TDFTDR85 bp++-
NeoFwdSD372 bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
10173A-G3VGB6C57BL/6NTac
10173A-G5VGB6C57BL/6NTac
10173B-A2VGB6C57BL/6NTac
10173D-B6VGB6C57BL/6NTac
10173D-B8VGB6C57BL/6NTac
10173D-B11VGB6C57BL/6NTac
10173D-C8VGB6C57BL/6NTac
10173D-E2VGB6C57BL/6NTac
10173D-F6VGB6C57BL/6NTac