10238   1700034O15Rik     Status: ES cell colonies screened / QC positives

Gene1700034O15Rik
Chromosome6
Deletion Start41,634,520
Deletion End41,635,389
Deletion Size870
Genome Build37
MGI IDMGI:1923856
NCBI Gene ID76606
BAC ID87B17
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 6

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF41,635,26141,635,282GGTGAGCAGTGGCAGGAGATAG
TUP41,635,28641,635,312TGGTCCAGCAAGAAGACACGATCTCCC
TUR41,635,31541,635,336GGTGGTCCTGGAGAGTTATTGC
TDF41,634,54441,634,567AGAGCAACATTCCTGACAGCTTTG
TDP41,634,56941,634,595CCTTCACTTGGAGCAGCAGCAGTAGCA
TDR41,634,60041,634,626AAGCTTGCACTCACTATCAGAGTCTTC

PCR Primers

PrimerSequence
SUATGACCATCTCAGATGCCTC
SDTGTCTTTGGCCCCGGGACATG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev372 bp-++
TUFTUR76 bp++-
TDFTDR83 bp++-
NeoFwdSD337 bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
10238B-D2VGB6C57BL/6NTac
10238B-D3VGB6C57BL/6NTac
10238B-F2VGB6C57BL/6NTac
10238B-F9VGB6C57BL/6NTac
10238B-G10VGB6C57BL/6NTac
10238B-H1VGB6C57BL/6NTac