10243   1700003F12Rik     Status: ES cell colonies screened / QC positives

Gene1700003F12Rik
Chromosome2
Deletion Start154,374,662
Deletion End154,375,700
Deletion Size1,039
Genome Build37
MGI IDMGI:1922730
NCBI Gene ID75480
BAC ID212G12
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 2

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF154,374,754154,374,773AAGCCCGTCACAAGCAGTTC
TUP154,374,775154,374,800TCAGCCATCTCAAGAGGAAGAAGCCA
TUR154,374,808154,374,829GTCCCTTCTAGCCTCTCCATAC
TDF154,375,271154,375,290CCCAGACCAAGATCGTGCTG
TDP154,375,291154,375,314CTTTTCCCGCTGGACAAGCGGCAG
TDR154,375,340154,375,357GCACCGGCCTCACAAATG

PCR Primers

PrimerSequence
SUCTAGCCCTGTTTTGCAGCTG
SDTCAAGTCCACCTTCAGTCTAC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev356 bp-++
TUFTUR76 bp++-
TDFTDR87 bp++-
NeoFwdSD291 bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
10243A-C10VGB6C57BL/6NTac
10243A-E8VGB6C57BL/6NTac