10302   1810030O07Rik     Status: ES cell clone microinjected

Gene1810030O07Rik
ChromosomeX
Deletion Start12,250,664
Deletion End12,234,969
Deletion Size15,696
Genome Build37
MGI IDMGI:1916405
NCBI Gene ID69155
BAC ID325M5
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome X

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF12,250,28312,250,304CACCTCTGCCCTCTGTAGTTTC
TUP12,250,25812,250,282AGCCTCAGTGTCAGGTATGCGCAGA
TUR12,250,20712,250,227TGCACGTCTCCATTTCTGTTG
TDF12,235,38812,235,407TGCCATCCACTCAACCTCTG
TDP12,235,36312,235,387TGTAGATGCTTGCCAGTAGTCCGCA
TDR12,235,31712,235,336GCCCTAAACCACCTGTTCTG

PCR Primers

PrimerSequence
SUGCTGCCACTTCCTGGAGCGG
SDACCATTCCCAACCTTCCTTTC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev288 bp-++
TUFTUR98 bp++-
TDFTDR91 bp++-
NeoFwdSD216 bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
10302A-A10VGB6C57BL/6NTac
10302A-A11VGB6C57BL/6NTac
10302A-B2VGB6C57BL/6NTac
10302A-E6VGB6C57BL/6NTac
10302B-B5VGB6C57BL/6NTac
10302B-E5VGB6C57BL/6NTac
10302B-B6VGB6C57BL/6NTac