10311   N28178     Status: ES cell colonies screened / QC positives

GeneN28178
Chromosome4
Deletion Start42,946,475
Deletion End42,952,478
Deletion Size6,004
Genome Build37
MGI IDMGI:2140712
NCBI Gene ID230085
BAC ID134P22
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 4

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF42,946,75242,946,771CGTCGAGCCTGAGGAGTTTG
TUP42,946,77342,946,793CAGGACCAGCCGATTCACGCC
TUR42,946,81842,946,838GGTTTGTCATCGTCCAGCTTC
TDF42,951,76842,951,787TGCCCGTGAACTAAGCAGAG
TDP42,951,79042,951,815CAGCAATCCTATCGGCAGTCTGTGGG
TDR42,951,82142,951,843GCGGCAGAGAATTTAGGACAGAG

PCR Primers

PrimerSequence
SUCTATGTTATCCTCATGACAACC
SDTGCACACACGTATGCGTGAG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev338 bp-++
TUFTUR87 bp++-
TDFTDR76 bp++-
NeoFwdSD363 bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
10311A-H2VGB6C57BL/6NTac
10311C-G7VGB6C57BL/6NTac
10311D-D7VGB6C57BL/6NTac
10311E-F10VGB6C57BL/6NTac
10311E-F4VGB6C57BL/6NTac