10571   Nhlrc1     Status: ES cell colonies screened / QC positives

GeneNhlrc1
Chromosome13
Deletion Start47,110,145
Deletion End47,108,572
Deletion Size1,574
Genome Build37
MGI IDMGI:2145264
NCBI Gene ID105193
BAC ID274C23
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 13

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF47,109,54347,109,562GCGACTGCTCCCTCAAAGTG
TUP47,109,51247,109,540TGATTTCTTTGGCCAGATCAAGCTGGTTG
TUR47,109,42847,109,448AAGTCCCTGCCTCTGCATCAG
TDF47,109,27047,109,289TTGGGAGGACTGGCTGTAAC
TDP47,109,24147,109,267CACAAGGGTGAAGGTGTTCAACTCCAC
TDR47,109,20647,109,224GCCCGAAGCTATCCACCTG

PCR Primers

PrimerSequence
SUTGATTATCCCAGGTCTGCGC
SDGCAGCCTTTGCCTTATAAGG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev276 bp-++
TUFTUR135 bp++-
TDFTDR84 bp++-
NeoFwdSD334 bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
10571D-E2VGB6C57BL/6NTac
10571E-H8VGB6C57BL/6NTac