10591   Cldn16     Status: ES cell colonies screened / QC positives

GeneCldn16
Chromosome16
Deletion Start26,463,554
Deletion End26,482,737
Deletion Size19,184
Genome Build37
MGI IDMGI:2148742
NCBI Gene ID114141
BAC ID407E12
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 16

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF26,464,22326,464,241CTCAGGAACAGGCGTGGAC
TUP26,464,25126,464,280CCACTCTAAACAACTGGTTACACAGCAGGA
TUR26,464,28726,464,308ACCCAGTCACCTCCCTCATAAG
TDF26,482,63426,482,655CCATGAGGAAGCCCTATTCAAC
TDP26,482,65626,482,676TGCAGGTGTGTCCATGGCCAA
TDR26,482,69526,482,718GCATACATTTTGGCTGTCTCTGTC

PCR Primers

PrimerSequence
SUTGCCACAGCCACAGGCCTCTG
SDCTCCAAAGCAATAAAGACAC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev474 bp-++
TUFTUR86 bp++-
TDFTDR85 bp++-
NeoFwdSD337 bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
10591A-C7VGB6C57BL/6NTac
10591A-H8VGB6C57BL/6NTac