10675   Taar5     Status: ES cell colonies screened / QC positives

GeneTaar5
Chromosome10
Deletion Start23,690,515
Deletion End23,691,552
Deletion Size1,038
Genome Build37
MGI IDMGI:2685073
NCBI Gene ID215854
BAC ID345H13
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 10

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF23,690,80223,690,821GAGCTGCTGGTTCTTTGGAG
TUP23,690,82223,690,848ACTTCCTGTGCCGTCTGCATACCTATC
TUR23,690,86623,690,888CAGAGATGGAAGATGGAGGTGAG
TDF23,691,40923,691,432TGTAATCCCATCATCTACGTCTTC
TDP23,691,43523,691,460CTACCGGTGGTTTAGGAAGGCACTGA
TDR23,691,48623,691,505CAGTCGGTGTCCTTGGTGAG

PCR Primers

PrimerSequence
SUGAAGAGCCTTGTGTGATAGAC
SDGACTTCCTCCTGTGCTTCTC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev405 bp-++
TUFTUR87 bp++-
TDFTDR97 bp++-
NeoFwdSD348 bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
10675A-A8VGB6C57BL/6NTac
10675A-A9VGB6C57BL/6NTac
10675A-A10VGB6C57BL/6NTac
10675A-C4VGB6C57BL/6NTac
10675A-C8VGB6C57BL/6NTac
10675A-F11VGB6C57BL/6NTac