10749   Taar6     Status: ES cell clone microinjected

GeneTaar6
Chromosome10
Deletion Start23,705,449
Deletion End23,704,415
Deletion Size1,035
Genome Build37
MGI IDMGI:2685074
NCBI Gene ID215855
BAC ID267O9
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 10

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF23,705,06423,705,085TGAGCTTCATCTCCATCGACAG
TUP23,705,03923,705,061ACATCGCTGTCACGGACCCTCTG
TUR23,705,01723,705,038CCGTGAACTTGGTGGGATAGAC
TDF23,704,54423,704,567TGTGTTTGGTGTGCTTATTACAAC
TDP23,704,51823,704,543TCAGCCATGAACCCTCTGATCTACGC
TDR23,704,43623,704,457GTTCATAGTGGCTGAGCTGTTC

PCR Primers

PrimerSequence
SUCCATTATTTTGGACCATAGGAGC
SDGTTCAGCTCTGAGAAGAGAAC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR69 bp++-
TDFTDR132 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
10749A-D5VGB6C57BL/6NTac
10749A-D6VGB6C57BL/6NTac
10749A-E2VGB6C57BL/6NTac
10749A-G3VGB6C57BL/6NTac
10749A-H10VGB6C57BL/6NTac
10749A-H11VGB6C57BL/6NTac