10866   H1fx     Status: ES cell colonies screened / QC positives

GeneH1fx
Chromosome6
Deletion Start87,931,347
Deletion End87,930,784
Deletion Size564
Genome Build37
MGI IDMGI:2685307
NCBI Gene ID243529
BAC ID454N16
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 6

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF87,931,22887,931,249GAGAAGGAAGAACCGCAAGAAG
TUP87,931,20587,931,227AACCAGCCAGGCAAGTACAGCCA
TUR87,931,12987,931,147CCTGGCCTCAGCGTAGATG
TDF87,930,86587,930,883CGCGCACAAGAGCAAGAAG
TDP87,930,83587,930,856TGCTGCCAGCGCGAAGAAAGTG
TDR87,930,80587,930,822CTTGGGCACGCTGGGTTT

PCR Primers

PrimerSequence
SUGCCGCGGGCGGAGGAGCCAG
SDGGTTGGAACCGTTTATTGCG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev554 bp-++
TUFTUR121 bp++-
TDFTDR79 bp++-
NeoFwdSD466 bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
10866A-D7VGB6C57BL/6NTac
10866A-F5VGB6C57BL/6NTac
10866A-E9VGB6C57BL/6NTac
10866A-F4VGB6C57BL/6NTac
10866A-E2VGB6C57BL/6NTac