11076   1700012A03Rik     Status: ES cell colonies screened / QC positives

Gene1700012A03Rik
Chromosome6
Deletion Start32,001,618
Deletion End32,008,780
Deletion Size7,163
Genome Build37
MGI IDMGI:1923632
NCBI Gene ID76382
BAC ID120C2
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 6

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF32,002,10932,002,129CCTCCAGTGTGGCACAGTTAG
TUP32,002,13032,002,154CCTCAGCAGCAAGGAAATGGAAGCA
TUR32,002,15532,002,176TGGCACCAAGGATGGTTTATTC
TDF32,007,99732,008,017TTCCTTCAGGTGGGACTTCAG
TDP32,008,02032,008,046TGTGGGCTGGGAAGTTATCCTACCTGT
TDR32,008,06032,008,081CCAGGACATTGTCTGGTGATTC

PCR Primers

PrimerSequence
SUTGGCTGTGGAGCCAGGAAG
SDATTGTGGGAAGACATCCAGG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev292 bp-++
TUFTUR68 bp++-
TDFTDR85 bp++-
NeoFwdSD338 bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
11076C-E3VGB6C57BL/6NTac
11076C-F11VGB6C57BL/6NTac