11287   G0s2     Status: ES cell colonies screened / QC positives

GeneG0s2
Chromosome1
Deletion Start195,098,965
Deletion End195,098,637
Deletion Size329
Genome Build37
MGI IDMGI:1316737
NCBI Gene ID14373
BAC ID293E7
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 1

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF195,098,915195,098,936CAAGGAGATGATGGCGCAGAAG
TUP195,098,886195,098,913CCCGAGGGAAGCTAGTGAAGCTATACGT
TUR195,098,841195,098,859ACTAGGCCGAGCACCACAC
TDF195,098,755195,098,773CTGCGGGAAGCGTGTGAAC
TDP195,098,732195,098,754AGCAGTCCCTCCACAAGCAGGCC
TDR195,098,705195,098,724CTCCTGTGCCTTGCCTCCTG

PCR Primers

PrimerSequence
SUTGGGCAAGAGACACCAGAC
SDATCACAGTGCGTGCTGCAC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev303 bp-++
TUFTUR96 bp++-
TDFTDR69 bp++-
NeoFwdSD238 bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
11287A-G11VGB6C57BL/6NTac
11287A-F11VGB6C57BL/6NTac
11287A-G1VGB6C57BL/6NTac
11287A-D11VGB6C57BL/6NTac