11384   Taar2     Status: ES cell colonies screened / QC positives

GeneTaar2
Chromosome10
Deletion Start23,658,381
Deletion End23,661,449
Deletion Size3,069
Genome Build37
MGI IDMGI:2685071
NCBI Gene ID209512
BAC ID
BAC Library
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 10

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF23,659,25823,659,279TCAACATGGATGGAGGGACTTC
TUP23,659,28123,659,302TGGGCCCTAGTTGATGGCCCTG
TUR23,659,32123,659,340TCTGAACCCACATGGCACTG
TDF23,660,59423,660,615CACCGACTTCCTTCTCGGATTC
TDP23,660,62123,660,650CATGCCATATAGTATGGTCAGGTCAGTGGA
TDR23,660,65423,660,675CGTAAGTCCGAAATACCAGCAG

PCR Primers

PrimerSequence
SUATCAGAATTGAGAGCCTCCG
SDAAATCATCTCTCTCACTTCCACC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR83 bp++-
TDFTDR82 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
11384A-A5VGB6C57BL/6NTac
11384A-E5VGB6C57BL/6NTac
11384A-G12VGB6C57BL/6NTac
11384A-F6VGB6C57BL/6NTac