11487   Taar4     Status: ES cell colonies screened / QC positives

GeneTaar4
Chromosome10
Deletion Start23,680,303
Deletion End23,681,593
Deletion Size1,291
Genome Build37
MGI IDMGI:2685072
NCBI Gene ID209513
BAC ID345H13
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 10

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF23,680,52523,680,547GCTACCACAGACTTCCTGTTGAG
TUP23,680,54923,680,573TGCGTGGTCATGCCCTTCAGTATGA
TUR23,680,58523,680,605TCCGAAGTACCAGCATGACTC
TDF23,681,26023,681,281CGAAAGGCCCTGAGGATGATAG
TDP23,681,28223,681,306TCACAGGAACGATCTTCCGCTCTGA
TDR23,681,31223,681,332CAGGATGCAGGCTTGAGGTAG

PCR Primers

PrimerSequence
SUGGGAAACGAATTCTGGTCAG
SDGTAATTCAGGCCTCAGCAGC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR81 bp++-
TDFTDR73 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
11487A-A1VGB6C57BL/6NTac
11487A-H6VGB6C57BL/6NTac
11487A-F1VGB6C57BL/6NTac