11601   1110001J03Rik     Status: ES cell colonies screened / QC positives

Gene1110001J03Rik
Chromosome6
Deletion Start38,484,856
Deletion End38,489,368
Deletion Size4,513
Genome Build37
MGI IDMGI:1913367
NCBI Gene ID66117
BAC ID122O23
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 6

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF38,485,09038,485,111TCAGGACAAACGTGTCTGAGTC
TUP38,485,11438,485,135CCTGTCCTCCACCTGCGGGTCT
TUR38,485,13638,485,155AAGGGCTGGAGTCTGTGGTG
TDF38,489,20238,489,221TCCAAGCTGCCACCTATCTC
TDP38,489,22738,489,254TTTGAGTAGCATCCGGCAACATGTAGCC
TDR38,489,29138,489,310AAACCAGCAGACTCCTCCAC

PCR Primers

PrimerSequence
SUGCTTACGGCAGTCCAAAGG
SDAAAGTTCAGCCAATTTACTCTG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev312 bp-++
TUFTUR66 bp++-
TDFTDR109 bp++-
NeoFwdSD589 bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
11601A-A1VGB6C57BL/6NTac
11601A-A4VGB6C57BL/6NTac
11601A-A10VGB6C57BL/6NTac
11601A-B7VGB6C57BL/6NTac
11601A-D7VGB6C57BL/6NTac
11601A-D3VGB6C57BL/6NTac