11602   F13a1     Status: ES cell colonies screened / QC positives

GeneF13a1
Chromosome13
Deletion Start37,139,352
Deletion End37,117,545
Deletion Size21,808
Genome Build37
MGI IDMGI:1921395
NCBI Gene ID74145
BAC ID462K20
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 13

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF37,138,78837,138,806GGTGAGAGGTGCCAGATTC
TUP37,138,76137,138,787TGACAGTAACAGAGATGGAAGCCCTCA
TUR37,138,72437,138,743TGCCTTGCCTTGTCCCTTAG
TDF37,118,05537,118,075GTCTCACATAGGGAGGGACAG
TDP37,118,03337,118,054TCGCAACAGGAAGAGCCCGACT
TDR37,117,98437,118,008GGTCAGAGTTCAAGTGTTCAGATTC

PCR Primers

PrimerSequence
SUATATGCAGGCTTTGAGGTGC
SDACAATGGTAAGATGCGAAACC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev444 bp-++
TUFTUR83 bp++-
TDFTDR92 bp++-
NeoFwdSD352 bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
11602B-B6VGB6C57BL/6NTac
11602B-H8VGB6C57BL/6NTac