11622   0610037L13Rik     Status: ES cell colonies screened / QC positives

Gene0610037L13Rik
Chromosome4
Deletion Start107,562,594
Deletion End107,569,564
Deletion Size6,971
Genome Build37
MGI IDMGI:1921348
NCBI Gene ID74098
BAC ID179F24
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 4

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF107,563,376107,563,394GCCCTAGAGGCCCAAACAG
TUP107,563,399107,563,422ACACCCTTCATCGTCCCAGGCTGT
TUR107,563,443107,563,462TGGGTATGTGAGGCACTGAG
TDF107,568,756107,568,776TGCTGACTGCAATTCCTCCAG
TDP107,568,778107,568,800ATGGTCACCACCAGGCGATCCCA
TDR107,568,858107,568,879TGTGACGTGGGCCTAAATGAAG

PCR Primers

PrimerSequence
SUAAGCAGCTGTCGCAGCGAC
SDGGATCAGGTACAGAATAGGG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev268 bp-++
TUFTUR87 bp++-
TDFTDR124 bp++-
NeoFwdSD336 bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
11622A-B4VGB6C57BL/6NTac
11622A-D9VGB6C57BL/6NTac
11622A-C2VGB6C57BL/6NTac