11696   1520402A15Rik     Status: ES cell colonies screened / QC positives

Gene1520402A15Rik
Chromosome4
Deletion Start115,819,039
Deletion End115,811,858
Deletion Size7,182
Genome Build37
MGI IDMGI:1915325
NCBI Gene ID68075
BAC ID397D2
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 4

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUFGGGTTGAAAGCAGAGTGAAGTG
TUPTATTTGTCTCCCAAGGGTGAATGAAGGGTT
TURTCCAAGAGATGTGCCTCCTAC
TDFAAGCCCAGGACGCTCAAG
TDPCAGTTGGGACAGCCTGCCAGACA
TDRCAAGAAGCTGCCAATAGAGACAC

PCR Primers

PrimerSequence
SUTTCAGTTCCAAATCCAGGATC
SDCTTACAACAGGAGCCACAGG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
11696A-D9VGB6C57BL/6NTac
11696A-F12VGB6C57BL/6NTac
11696A-G10VGB6C57BL/6NTac
11696A-H6VGB6C57BL/6NTac
11696A-H9VGB6C57BL/6NTac