11715   0610031J06Rik     Status: ES cell colonies screened / QC positives

Gene0610031J06Rik
Chromosome3
Deletion Start88,129,007
Deletion End88,132,309
Deletion Size3,303
Genome Build37
MGI IDMGI:1913318
NCBI Gene ID56700
BAC ID359E10
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 3

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF88,129,30088,129,320GTCCTGCTTTCTGACGATGTC
TUP88,129,32588,129,349CCATGGCTCAGCCATTGTAGCCCAG
TUR88,129,37888,129,399CAGAGGGCTCAGAGCTAACAAG
TDF88,131,34888,131,370CCTACCGAGTGCTGGGATTAAAG
TDP88,131,37688,131,398CGCCATCACGCCTGGCTATGGTC
TDR88,131,45688,131,476CACAGATGGCAGGCAATAGAC

PCR Primers

PrimerSequence
SUTTCACCAGAGGTGATGTAGG
SDGGGAAATGTCTATTTCATGCC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR100 bp++-
TDFTDR129 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
11715A-A2VGB6C57BL/6NTac
11715A-H7VGB6C57BL/6NTac
11715A-E3VGB6C57BL/6NTac
11715A-H5VGB6C57BL/6NTac
11715A-F2VGB6C57BL/6NTac