11780   Lsm10     Status: ES cell colonies screened / QC positives

GeneLsm10
Chromosome4
Deletion Start125,775,100
Deletion End125,775,481
Deletion Size382
Genome Build37
MGI IDMGI:2151045
NCBI Gene ID116748
BAC ID217E16
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 4

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF125,775,189125,775,208GGACCTTCGGGATGAGAGTG
TUP125,775,212125,775,235CCCGAGGACGCATTGACAACGTGG
TUR125,775,260125,775,283AGCGGTCGGTATAGGTGACATTGG
TDF125,775,357125,775,381TGTGGACATCACTGCTACTATTGAG
TDP125,775,385125,775,409CAGCTGCAGATCATCCACCGTGTGC
TDR125,775,411125,775,431TGACCCTTGCCACCAAAGTTG

PCR Primers

PrimerSequence
SUAACAAAACAATCTGGGCCTG
SDGGGCCACATTCTAGACCAAG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR95 bp++-
TDFTDR75 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
11780A-A10VGB6C57BL/6NTac
11780A-C9VGB6C57BL/6NTac
11780A-C12VGB6C57BL/6NTac
11780A-E6VGB6C57BL/6NTac