11827   1700011F03Rik     Status: ES cell colonies screened / QC positives

Gene1700011F03Rik
Chromosome6
Deletion Start70,868,777
Deletion End70,864,314
Deletion Size4,464
Genome Build37
MGI IDMGI:1921471
NCBI Gene ID74221
BAC ID158P8
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 6

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF70,867,21670,867,236TCTAGCTCAGTGTCTGGGAAC
TUP70,867,18770,867,214TCTAATCCTCTGCCTGCTATCCTAGGCC
TUR70,867,14070,867,163GCCATGTGAGATTTAGGGTAAGTG
TDF70,864,08770,864,106TGCATGAGGACCTGGGTTTG
TDP70,864,05270,864,078AACCCACAGGCACAGTAGCATGTCTCA
TDR70,864,02470,864,045CCTGTCTGTCTCCCTAGCACTG

PCR Primers

PrimerSequence
SUAACGGATCTGATATTTTGAGTG
SDCTACATACATTCTATACACACC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR97 bp++-
TDFTDR83 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
11827A-A1VGB6C57BL/6NTac
11827A-A12VGB6C57BL/6NTac
11827A-E3VGB6C57BL/6NTac
11827A-D3VGB6C57BL/6NTac
11827A-C6VGB6C57BL/6NTac
11827A-F3VGB6C57BL/6NTac