11854   5730403B10Rik     Status: ES cell colonies screened / QC positives

Gene5730403B10Rik
Chromosome16
Deletion Start4,789,144
Deletion End4,787,558
Deletion Size1,587
Genome Build37
MGI IDMGI:1913876
NCBI Gene ID66626
BAC ID328P18
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 16

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF4,769,5594,769,579TGGCAGCTAGGAGGAACTTTG
TUP4,769,5304,769,555CCACCAAGGAAGGTTACAGTGGCTCA
TUR4,769,5034,769,522GCTCCCACCTTACCACAGAC
TDF4,769,1314,769,148GCCTCTTCCTGCTGACAC
TDP4,769,1064,769,130TCTGACCCTCTTCTGGAAGACAGCA
TDR4,769,0754,769,094TCCAACACTCAACGCACAAC

PCR Primers

PrimerSequence
SUTGCTGGATCTATCCACCAAC
SDAGCAACACACAAGATTAGTGC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR77 bp++-
TDFTDR74 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
11854A-A1VGB6C57BL/6NTac
11854A-E1VGB6C57BL/6NTac
11854A-E7VGB6C57BL/6NTac
11854A-H4VGB6C57BL/6NTac