11858   Atp5g1     Status: Germline transmission achieved

GeneAtp5g1
Chromosome11
Deletion Start95,932,767
Deletion End95,930,814
Deletion Size1,954
Genome Build37
MGI IDMGI:107653
NCBI Gene ID11951
BAC ID73J11
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 11

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF95,935,88895,935,907CCCAGGTGATGCCAATGTTC
TUP95,935,86195,935,887TGCCAAGCCTGAGAGTCATTGTACTGA
TUR95,935,81595,935,837CCATCTTAGGAAAGCTCCCAGTG
TDF95,934,88395,934,902TGGTGTGGCTGGATCAGGAG
TDP95,934,85795,934,882CTGGCATTGGCACAGTGTTTGGTAGC
TDR95,934,79595,934,816CCAAGTGGAGTGGAGCAACAAC

PCR Primers

PrimerSequence
SUTCGGTTGCTGTCCTTCTGC
SDAAGTGACAAAGCACCAACATC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR93 bp++-
TDFTDR108 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
11858A-D10VGB6C57BL/6NTac
11858A-F4VGB6C57BL/6NTac
11858A-F10VGB6C57BL/6NTac
11858A-F12VGB6C57BL/6NTac