11870   1810027O10Rik     Status: ES cell colonies screened / QC positives

Gene1810027O10Rik
Chromosome11
Deletion Start69,652,070
Deletion End69,653,136
Deletion Size1,067
Genome Build37
MGI IDMGI:1916436
NCBI Gene ID69186
BAC ID420I24
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 11

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF69,652,30469,652,327ACTACATCTGTTTCCACCAGTCAG
TUP69,652,33469,652,360CCAGGGATGCAGTGTCTACTTAGGTGC
TUR69,652,37269,652,396GAACTGTATTGGCTTAGACCCTCTC
TDF69,652,90469,652,924TGCACCAGCTTCTACTACCAG
TDP69,652,92769,652,950TCTGAGTGGAGACACCAGCATCCA
TDR69,652,97969,652,999GGCAAGCCAGCCCAAGATTAG

PCR Primers

PrimerSequence
SUGTGACGCAAATCCTCTAGTC
SDCTCATGTGCTCTTTAGGTAAG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR93 bp++-
TDFTDR96 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
11870A-E4VGB6C57BL/6NTac
11870C-B4VGB6C57BL/6NTac
11870C-E12VGB6C57BL/6NTac