12050   Calcoco2     Status: ES cell colonies screened / QC positives

GeneCalcoco2
Chromosome11
Deletion Start95,968,906
Deletion End95,961,227
Deletion Size7,680
Genome Build37
MGI IDMGI:1343177
NCBI Gene ID76815
BAC ID73J11
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 11

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF95,967,97695,967,999TGCAAGCAGGACTTAGTAAGATGG
TUP95,967,95095,967,974TGAACCTTAGAGTTTTGATAGCTTT
TUR95,967,92295,967,944AGGAGATCCTGTCTGGACCCTTC
TDF95,962,20595,962,224AGCTGTCACCGTGGACACTG
TDP95,962,17795,962,202CACTAGAAGCAGAGCCTGCAAGAGCA
TDR95,962,14095,962,162CAACAGGCATCCAAGGACTAGAG

PCR Primers

PrimerSequence
SUCTAGTGTGGGAAGGCAGTGG
SDTGAGTCCTTTTGAGACAGGG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR78 bp++-
TDFTDR85 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
12050A-C2VGB6C57BL/6NTac
12050A-D4VGB6C57BL/6NTac
12050A-F7VGB6C57BL/6NTac
12050A-E5VGB6C57BL/6NTac