12661   Jakmip1     Status: ES cell colonies screened / QC positives

GeneJakmip1
Chromosome5
Deletion Start37,476,612
Deletion End37,498,554
Deletion Size21,943
Genome Build37
MGI IDMGI:1923321
NCBI Gene ID76071
BAC ID460K11
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 5

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF37,477,40337,477,423TCGGAAGCTGAGAGCAGTTAG
TUP37,477,42637,477,453TGAGCCAGTGTTCAGCTTGCTTTCTTCA
TUR37,477,46237,477,482GCTGCACAGCAATGGAGAATG
TDF37,497,77337,497,792GACCAGTCTGCCAGGATCTG
TDP37,497,79837,497,820ATCCAGGCCCAGCTTTGTCCTGC
TDR37,497,83237,497,852TCTCCCTTTCAGCACACTCTC

PCR Primers

PrimerSequence
SUAGGAGGTGAGACTCTGCCTG
SDAATGAGGCTGAGTGTCCTTC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR80 bp++-
TDFTDR80 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
12661A-D9VGB6C57BL/6NTac
12661A-F7VGB6C57BL/6NTac