12862   2310039H08Rik     Status: ES cell colonies screened / QC positives

Gene2310039H08Rik
Chromosome17
Deletion Start46,909,765
Deletion End46,910,151
Deletion Size387
Genome Build37
MGI IDMGI:1914351
NCBI Gene ID67101
BAC ID447B8
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 17

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF46,909,87546,909,893GGTACAGAAGGGCCAGGAG
TUP46,909,89846,909,920CGGGCCTGGAGAAACGCCACATC
TUR46,909,93446,909,952AGAGACGCGGTGGGTTCAC
TDF46,910,00446,910,022CTGCACCATCGCCCTAGAC
TDP46,910,02346,910,045ACGAGGACGCAGCCTCCGACCAT
TDR46,910,11546,910,133TCATGCCCTCGGGAAACAC

PCR Primers

PrimerSequence
SUCGCATCTACACGTGCCAAAG
SDTTATGTGGCCAAGCACACTG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR78 bp++-
TDFTDR130 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
12862A-B8VGB6C57BL/6NTac
12862A-D11VGB6C57BL/6NTac