12876   2310009B15Rik     Status: ES cell colonies screened / QC positives

Gene2310009B15Rik
Chromosome1
Deletion Start140,753,391
Deletion End140,748,393
Deletion Size4,999
Genome Build37
MGI IDMGI:1916799
NCBI Gene ID69549
BAC ID106B8
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 1

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF140,753,356140,753,373ACGCTGGCGAGGGTATCG
TUP140,753,336140,753,355CTTGGGAGGCCACCGCCTCG
TUR140,753,291140,753,309GTCGAACCGAGGGTTGAGT
TDF140,749,079140,749,102ACAGTGTTCTGAAAGTCAGCCTTC
TDP140,749,050140,749,073TGTGCAGTCTCCTGGCTATGCCAG
TDR140,749,002140,749,024GGTGTGAGATTGACATGATGCTC

PCR Primers

PrimerSequence
SUTGCAGAATACGATCTAGCTTG
SDAGGTTCAAAGGCAGGTTTGC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR83 bp++-
TDFTDR101 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
12876A-B3VGB6C57BL/6NTac
12876A-D2VGB6C57BL/6NTac
12876A-B8VGB6C57BL/6NTac
12876A-G12VGB6C57BL/6NTac