12878   1600015I10Rik     Status: ES cell colonies screened / QC positives

Gene1600015I10Rik
Chromosome6
Deletion Start48,880,088
Deletion End48,883,560
Deletion Size3,473
Genome Build37
MGI IDMGI:1917011
NCBI Gene ID69761
BAC ID261G8
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 6

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF48,880,53148,880,552CAAAGCAGAGTACAGCCTCATC
TUP48,880,55348,880,575TACCGTACGCTGACAGAGGCCAC
TUR48,880,59148,880,612GTCAGTGGTGTCAAGGAAGAAC
TDF48,883,14648,883,168TCCTAGTACCCACTGCCTATGTC
TDP48,883,17348,883,196CTGTTGCCAACCACTGCCTAGACC
TDR48,883,20548,883,229ACTCAGTAACTACGACTGCTGGAAC

PCR Primers

PrimerSequence
SUCCTCTGACCCAGAAGGACAC
SDAGAGGGTTTCTCTGCCCTTG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR82 bp++-
TDFTDR84 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
12878A-E2VGB6C57BL/6NTac
12878B-A6VGB6C57BL/6NTac
12878B-B5VGB6C57BL/6NTac
12878B-B6VGB6C57BL/6NTac
12878B-C2VGB6C57BL/6NTac