12879   1810026J23Rik     Status: ES cell colonies screened / QC positives

Gene1810026J23Rik
Chromosome9
Deletion Start21,397,406
Deletion End21,398,316
Deletion Size911
Genome Build37
MGI IDMGI:1917023
NCBI Gene ID69773
BAC ID387K20
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 9

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF21,397,48521,397,503CGGTTAAGCCAGGGCTGTG
TUP21,397,50521,397,529ACGCGACTGAGTGAGTAGTGGCAGA
TUR21,397,56121,397,578AGCTGCGGTGACAAGGAC
TDF21,398,10721,398,127AGCTGCACTCAGAGGCCAATG
TDP21,398,12821,398,155AGAGGCTGTTCGAGGAGAAGTACAAGCC
TDR21,398,15921,398,180CACCTGATCGTCGGTGAGTATG

PCR Primers

PrimerSequence
SUTGCATGGAGCCTAATACACG
SDAACAGGACTAATGCATGGGC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR94 bp++-
TDFTDR74 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
12879A-H2VGB6C57BL/6NTac
12879A-G4VGB6C57BL/6NTac
12879A-F11VGB6C57BL/6NTac
12879A-E6VGB6C57BL/6NTac