12919   Zar1     Status: ES cell colonies screened / QC positives

GeneZar1
Chromosome5
Deletion Start72,972,293
Deletion End72,968,471
Deletion Size3,823
Genome Build37
MGI IDMGI:2180337
NCBI Gene ID317755
BAC ID379B5
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 5

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF72,971,61072,971,627TGTCCTGCCGCAGAGATG
TUP72,971,58772,971,607TCAGGACCCCGGTGATTCGGA
TUR72,971,54272,971,561TTGTCCTGCTCCGTGCTTTG
TDF72,968,84672,968,864GGCCCTGTGAAACCGAGAA
TDP72,968,82772,968,845TGGAAAGCCACTAAAGACT
TDR72,968,73872,968,756TGGGCACTGAGAACCAAGT

PCR Primers

PrimerSequence
SUCTAATCTCGGTGATGATTCTG
SDAGACCTACAGACTGAAGCTG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR86 bp++-
TDFTDR127 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
12919B-D10VGB6C57BL/6NTac
12919B-E9VGB6C57BL/6NTac
12919B-E3VGB6C57BL/6NTac