12944   U2af1l4     Status: ES cell colonies screened / QC positives

GeneU2af1l4
Chromosome7
Deletion Start31,348,378
Deletion End31,350,265
Deletion Size1,888
Genome Build37
MGI IDMGI:2678374
NCBI Gene ID233073
BAC ID352G7
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 7

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF31,348,96331,348,987CAACTTGTACCGGAATCCACAGAAC
TUP31,348,98931,349,014CAGCCCAAACTGCAGATGGATCACAC
TUR31,349,03131,349,050TGCCCAGTCCCTGAACTATC
TDF31,349,66931,349,692GCTTGAGTGTTTGATAGGGAGTTC
TDP31,349,69731,349,723TGATGGTGGCCTTCTCTGTCTTTAGGG
TDR31,349,74631,349,767GGGCCGTAGGTGCATAAAGTTG

PCR Primers

PrimerSequence
SUAAGACCCAAATGACAGACGC
SDGTGGGTTTCAATTACCAGGC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR88 bp++-
TDFTDR99 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
12944A-C4VGB6C57BL/6NTac
12944A-C9VGB6C57BL/6NTac
12944A-D3VGB6C57BL/6NTac
12944A-D8VGB6C57BL/6NTac