13123   Vamp5     Status: ES cell colonies screened / QC positives

GeneVamp5
Chromosome6
Deletion Start72,330,374
Deletion End72,319,246
Deletion Size11,129
Genome Build37
MGI IDMGI:1858622
NCBI Gene ID53620
BAC ID246C8
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 6

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF72,329,45572,329,475CGAGAGTACAGGGCAGAGATG
TUP72,329,42572,329,451TTTCAACTGGCTCTCAGCTCTTGAGGA
TUR72,329,37772,329,398TGAACAGCCAGATAACCTAACC
TDF72,320,06472,320,083GGCTTGCCTGCTTATCAGTG
TDP72,320,03772,320,063TGCAACTTCCGGGTTTCCTACAAGTCG
TDR72,320,01572,320,036CCCAAAGGCATCTTGGTGAAAC

PCR Primers

PrimerSequence
SUAGACGCACTCACCAAGGTG
SDTTTACTGAGCTCCAGTGGTG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR99 bp++-
TDFTDR69 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
13123A-E2VGB6C57BL/6NTac
13123A-E5VGB6C57BL/6NTac
13123A-F3VGB6C57BL/6NTac
13123A-G9VGB6C57BL/6NTac