13751   Qprt     Status: ES cell colonies screened / QC positives

GeneQprt
Chromosome7
Deletion Start134,265,496
Deletion End134,251,511
Deletion Size13,986
Genome Build37
MGI IDMGI:1914625
NCBI Gene ID67375
BAC ID251I14
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 7

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF134,265,201134,265,223GATGGACTGGTAGTGGGAGTTTG
TUP134,265,169134,265,192AGCAGCCCTGGACTCTGTCCCTTG
TUR134,265,124134,265,145ACAGGGATGAGACCGGACTTTG
TDF134,252,153134,252,173GCATTTCAGTCCCTCCACCAG
TDP134,252,128134,252,152AGACCTGCCTGGTGACAAGTGGTCC
TDR134,252,074134,252,096AAGACAGCCTCCTCCATCTACAG

PCR Primers

PrimerSequence
SUATAGGAGAGTGAGGTCCGGC
SDCCCTAGCCACACAGATAGGC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR100 bp++-
TDFTDR100 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
13751A-A9VGB6C57BL/6NTac
13751A-B11VGB6C57BL/6NTac
13751A-D9VGB6C57BL/6NTac
13751A-E4VGB6C57BL/6NTac
13751A-F9VGB6C57BL/6NTac
13751A-H9VGB6C57BL/6NTac