13992   Ydjc     Status: ES cell colonies screened / QC positives

GeneYdjc
Chromosome16
Deletion Start17,147,079
Deletion End17,148,623
Deletion Size1,545
Genome Build37
MGI IDMGI:1916351
NCBI Gene ID69101
BAC ID401F9
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 16

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF17,147,39317,147,412AACGCCTCGTCGCTCCTCAG
TUP17,147,41417,147,438CCCGAAGGCTTCTTTCTCGGCAAGA
TUR17,147,44117,147,461CGCTAAAGCCTCCCGAAATCC
TDF17,148,20717,148,225CCGGTCCTTGAGGCAACAC
TDP17,148,22717,148,253TCTGATATCCTGGCACTCACAGGTGGA
TDR17,148,26117,148,282ACAAGTGCTCAGGCCCACAAAG

PCR Primers

PrimerSequence
SUATTTGCAGAGCGTTAGCAGG
SDGCATGTGCAGAATTGGAATG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR69 bp++-
TDFTDR76 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
13992A-A3VGB6C57BL/6NTac
13992A-A11VGB6C57BL/6NTac
13992A-B11VGB6C57BL/6NTac
13992A-C5VGB6C57BL/6NTac
13992A-G2VGB6C57BL/6NTac
13992A-G6VGB6C57BL/6NTac