13995   0610010K14Rik     Status: ES cell colonies screened / QC positives

Gene0610010K14Rik
Chromosome11
Deletion Start70,051,303
Deletion End70,048,899
Deletion Size2,405
Genome Build37
MGI IDMGI:1915609
NCBI Gene ID104457
BAC ID183L4
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 11

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF70,050,89670,050,919GCTCAGTGTAGGTGGTAATTGTTG
TUP70,050,86170,050,889TGGATGACAGGTAAAGAGACTACCGAGGC
TUR70,050,81770,050,835GGGTAGGTGGCAGACATTC
TDF70,049,59370,049,613GGTGTCCTCTCACCTCCAAAC
TDP70,049,56870,049,589CCTCCACCCAGCAGCTCCAGTG
TDR70,049,50670,049,525AGCAACTCCACAGCCCTCAC

PCR Primers

PrimerSequence
SUCTTGCTGTCTGTGCTTTCAG
SDAATATTGGCTGTGCTGCTCC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR103 bp++-
TDFTDR108 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
13995A-H10VGB6C57BL/6NTac
13995A-B4VGB6C57BL/6NTac
13995A-H3VGB6C57BL/6NTac
13995A-E11VGB6C57BL/6NTac
13995A-E3VGB6C57BL/6NTac
13995A-D8VGB6C57BL/6NTac