13996   0610011F06Rik     Status: ES cell colonies screened / QC positives

Gene0610011F06Rik
Chromosome17
Deletion Start26,012,478
Deletion End26,014,029
Deletion Size1,552
Genome Build37
MGI IDMGI:1915597
NCBI Gene ID68347
BAC ID114H11
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 17

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUFTGCAAAGAGGAAAGCATGAGTC
TUPTCCAGCTCCCGGCTTACTGTGC
TURTGCAGAGGAAGGCAAGTAGG
TDFGGAGCCTCCCTGTGATTAAGAG
TDPTCACTCCAGCCTGGCATGGTGG
TDRCCTTGGCTGTCCTGGAACTC

PCR Primers

PrimerSequence
SUACAGCTGAAAGACTCCAGG
SDGGAATCCTTCCAGTAGATGG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
13996A-A2VGB6C57BL/6NTac
13996A-A9VGB6C57BL/6NTac
13996A-B1VGB6C57BL/6NTac
13996A-D1VGB6C57BL/6NTac
13996A-C3VGB6C57BL/6NTac
13996A-B12VGB6C57BL/6NTac