14001   1110032A03Rik     Status: ES cell colonies screened / QC positives

Gene1110032A03Rik
Chromosome9
Deletion Start50,576,001
Deletion End50,571,956
Deletion Size4,046
Genome Build37
MGI IDMGI:1915971
NCBI Gene ID68721
BAC ID287K22
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 9

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF50,575,91550,575,939GAAGTAACATTGAACGCCTGTCTTG
TUP50,575,88650,575,913TCCATAGCACTGTGAGAGCAACTAGGTG
TUR50,575,86150,575,881GCAGGCCACTTCCAGTTCATC
TDF50,572,04050,572,060CAAATGCACAGCGAAGTCAAC
TDP50,572,00750,572,035ATGACTAACTACTCAGAACCTCAGCCCAC
TDR50,571,95750,571,975GGCCCTAAGACTGGCTCAC

PCR Primers

PrimerSequence
SUGATGACGCATCAACAGCTTG
SDTGCTTTATTTAGACAGCAGCC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR79 bp++-
TDFTDR104 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
14001A-D8VGB6C57BL/6NTac
14001A-E8VGB6C57BL/6NTac
14001A-C10VGB6C57BL/6NTac