14003   1110057K04Rik     Status: ES cell colonies screened / QC positives

Gene1110057K04Rik
Chromosome12
Deletion Start8,227,411
Deletion End8,245,416
Deletion Size18,006
Genome Build37
MGI IDMGI:1916082
NCBI Gene ID68832
BAC ID180P14
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 12

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF8,228,2138,228,234CATGGGATCAGTAAGGCTGTTG
TUP8,228,2358,228,258TTGCCCTCCTGGTCTTCAGGGATG
TUR8,228,3018,228,318TGCAAGGAGGCAGAGGAC
TDF8,245,0218,245,044TGAGTCGAGCTGTTTCAGATAGTG
TDP8,245,0538,245,077CCAGTTCTGTGCGAAGGGCGAGTTA
TDR8,245,1118,245,130TGCATCCCAGGCTTCTAGTC

PCR Primers

PrimerSequence
SUTCCAAGGGAACTGTCACTCC
SDCAGAGTCCTTCCCATGTCAC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR106 bp++-
TDFTDR110 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
14003A-H3VGB6C57BL/6NTac
14003A-A7VGB6C57BL/6NTac
14003A-D9VGB6C57BL/6NTac