14004   1110058L19Rik     Status: ES cell colonies screened / QC positives

Gene1110058L19Rik
Chromosome1
Deletion Start24,012,436
Deletion End24,003,089
Deletion Size9,348
Genome Build37
MGI IDMGI:1915252
NCBI Gene ID68002
BAC ID424I14
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 1

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF24,012,09624,012,114GCAGAGGCATGAGGATCTC
TUP24,012,06824,012,095TGAGTTCAAGGTCAGCCTGGTTCAAACG
TUR24,012,03624,012,057TTGTTCTTTGCTCTACGTGTGC
TDF24,003,28924,003,308GATGACCCAGGCACTCACAC
TDP24,003,25824,003,286AGATCATGCAGTCCTGTCCTCAACATTGA
TDR24,003,23224,003,254AGCAGAGACGGCGAGAAATGAAG

PCR Primers

PrimerSequence
SUCCATCGGAATAGCTAAGAGC
SDCTCTCATCCCAGACTCTGCC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR79 bp++-
TDFTDR77 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
14004A-D8VGB6C57BL/6NTac
14004A-E5VGB6C57BL/6NTac
14004A-F4VGB6C57BL/6NTac
14004A-G9VGB6C57BL/6NTac
14004A-G12VGB6C57BL/6NTac