14006   1110059G10Rik     Status: ES cell colonies screened / QC positives

Gene1110059G10Rik
Chromosome9
Deletion Start122,860,027
Deletion End122,856,000
Deletion Size4,028
Genome Build37
MGI IDMGI:1913452
NCBI Gene ID66202
BAC ID218F16
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 9

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF122,859,846122,859,863TCGGTGCCGACGTAACTG
TUP122,859,824122,859,844CAGGTCCCTCACTCGCGACCA
TUR122,859,762122,859,786TCAAGAATAGCACCCTGCAAGTAAG
TDF122,856,372122,856,394GCTTCTGAAACCTCAAAGCACAC
TDP122,856,342122,856,370TCCTCCAGTAAAGCCATATCTCCTAGTCC
TDR122,856,299122,856,320ACAGCAGAGGCTCAGGGAGTAG

PCR Primers

PrimerSequence
SUCGATGAGTTCACCAGGCAG
SDCAGTGGAACTGTTTGTTACATG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR102 bp++-
TDFTDR96 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
14006A-C3VGB6C57BL/6NTac
14006A-D5VGB6C57BL/6NTac
14006A-G9VGB6C57BL/6NTac
14006A-E10VGB6C57BL/6NTac
14006A-G5VGB6C57BL/6NTac
14006A-D8VGB6C57BL/6NTac