14007   1600002K03Rik     Status: ES cell colonies screened / QC one positive

Gene1600002K03Rik
Chromosome10
Deletion Start79,635,714
Deletion End79,637,626
Deletion Size1,913
Genome Build37
MGI IDMGI:1917020
NCBI Gene ID69770
BAC ID174I19
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 10

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF79,635,84579,635,863GGTGCTCCGCTTGTTCTAC
TUP79,635,86579,635,886TAATCACTGGGCTCTGCGGCCT
TUR79,635,92479,635,941CTGATTGGCCGCGCTAAC
TDF79,637,51079,637,533CAACCAGTCCCATCCTTCAATACC
TDP79,637,53679,637,562ATCTTGTCCTGTTCCTTCCCTTGCAGA
TDR79,637,56779,637,587GCAGCCTGTCATCTCCATCTC

PCR Primers

PrimerSequence
SUAAGCTGGACTGGACTTTCCC
SDTGACATGAACAGGAGAGCCC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR97 bp++-
TDFTDR78 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
14007A-A12VGB6C57BL/6NTac