14011   1700016D06Rik     Status: ES cell colonies screened / QC positives

Gene1700016D06Rik
Chromosome8
Deletion Start11,678,666
Deletion End11,655,541
Deletion Size23,126
Genome Build37
MGI IDMGI:1923663
NCBI Gene ID76413
BAC ID453B23
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 8

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF11,678,54811,678,567CCCAGGAGACTGGCAGATAG
TUP11,678,51711,678,543CTATAGGCACGATGAATCAGGCAGGCA
TUR11,678,48511,678,508GAGCCCTTTCAAACAATAGCAGAG
TDF11,655,63111,655,653CCAGCAAAGTAGAAGCAGTCAAC
TDP11,655,59511,655,622AAGCCAATCCAGCCCTAAGTACTAGGCC
TDR11,655,57211,655,590GCAGTGGCTTGTCCCTCTC

PCR Primers

PrimerSequence
SUTGGAAGGAGATATGATGGGC
SDACAGACAAGGGAAGGTGCAG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR83 bp++-
TDFTDR82 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
14011A-D3VGB6C57BL/6NTac
14011A-F12VGB6C57BL/6NTac
14011A-E8VGB6C57BL/6NTac
14011A-F4VGB6C57BL/6NTac