14016   1810046J19Rik     Status: Cancelled

Gene1810046J19Rik
Chromosome11
Deletion Start98,300,257
Deletion End98,299,354
Deletion Size904
Genome Build37
MGI IDMGI:1913678
NCBI Gene ID103742
BAC ID
BAC Library
CassetteZEN-Ub1
Clones AvailableNo

Primer Genomic Coordinates on Chromosome 11

Please be aware that these oligonucleotides have been validated only by Taqman assay.

Taqman primers not yet available.

PCR Primers

PrimerSequence
SUTTGTGATCACAGGCAGTTCG
SDCTCTTTATTGCCAAGAGCCG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++