14106   Cbx6     Status: ES cell colonies screened / QC positives

GeneCbx6
Chromosome15
Deletion Start79,664,638
Deletion End79,624,691
Deletion Size39,948
Genome Build37
MGI IDMGI:3512628
NCBI Gene ID494448
BAC ID379K11
BAC LibraryRPCI 23
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 15

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUFCAGCACTTGGGAGCCAGAG
TUPAACATTCTGGATTCGAGGCTCATCGCA
TURCCTGCCAGCTTCTCCAACTC
TDFACTCTGCACGCTCTTCTCC
TDPACACAGGGTGTCAGAGCCGGCCT
TDRTCTTTGGCATTCAGGGTGTTC

PCR Primers

PrimerSequence
SUACAGCGCCTAGAGACTCCTG
SDTAAATCAGCCAGGGTGTCAC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
14106B-A2VGB6C57BL/6NTac
14106B-A6VGB6C57BL/6NTac
14106B-B11VGB6C57BL/6NTac
14106B-D8VGB6C57BL/6NTac