14117   Rab11fip1     Status: ES cell colonies screened / QC positives

GeneRab11fip1
Chromosome8
Deletion Start28,285,054
Deletion End28,253,579
Deletion Size31,476
Genome Build37
MGI IDMGI:1923017
NCBI Gene ID75767
BAC ID223C17
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 8

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF28,284,17728,284,196TGCTGATTCTCATGCCCATC
TUP28,284,13928,284,167CCCTCGGAATGAACGCTAGAACAGTTTGT
TUR28,284,11028,284,133CGACCACTAATTCAGATCCCAGAC
TDF28,253,78928,253,811TGATCCAGCTAGTCCTCAAACAG
TDP28,253,75428,253,781CCATCAGCAAGAAGGAGTTTCAGGTGCG
TDR28,253,72528,253,746GCAGGTTGTCGATGTAGTCCTC

PCR Primers

PrimerSequence
SUGGGACCAGAGCAGGAGAAG
SDCAAGAGAGCGGGTGAAACAG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR87 bp++-
TDFTDR87 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
14117A-D1VGB6C57BL/6NTac
14117A-E5VGB6C57BL/6NTac
14117A-F11VGB6C57BL/6NTac