14511   2410016O06Rik     Status: ES cell colonies screened / QC positives

Gene2410016O06Rik
Chromosome12
Deletion Start85,291,645
Deletion End85,293,488
Deletion Size1,844
Genome Build37
MGI IDMGI:1919202
NCBI Gene ID71952
BAC ID65M8
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 12

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF85,292,23285,292,253CAGCTACTACGAGGGTCTCTTC
TUP85,292,25485,292,273TCCACCGCCGACCTGGACTC
TUR85,292,29585,292,313CAGATGCTGCCCGAATTGC
TDF85,292,61685,292,634GGACCCGAGTGAGGAGTTG
TDP85,292,63785,292,663CCTGACATCTAGTCCCAACTTCAGCCA
TDR85,292,68985,292,709TCCAGGTTCCAGTACCGTTTG

PCR Primers

PrimerSequence
SUTTGAAATGCCTCGTGCCTTC
SDAACTTAACGCGCAGCACAC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR82 bp++-
TDFTDR94 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
14511A-D2VGB6C57BL/6NTac
14511A-E8VGB6C57BL/6NTac
14511A-D7VGB6C57BL/6NTac
14511A-E3VGB6C57BL/6NTac