14808   Xcl1     Status: ES cell colonies screened / QC positives

GeneXcl1
Chromosome1
Deletion Start166,865,618
Deletion End166,861,834
Deletion Size3,785
Genome Build37
MGI IDMGI:104593
NCBI Gene ID16963
BAC ID368L13
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 1

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF166,865,597166,865,618AGACTTCTCCTCCTGACTTTCC
TUP166,865,576166,865,596TGGGAGTCTGCTGCCTCACCC
TUR166,865,516166,865,538ATGAGCCCACCTCTTCTTTATCC
TDF166,861,929166,861,948TCCACCAGCACAGCGATAAC
TDP166,861,903166,861,928CCTGACTGGGTAACAGCCTCCAGGAC
TDR166,861,853166,861,873GCAATGGGTTTGGGAACTGAG

PCR Primers

PrimerSequence
SUTTCAGGATGGAAGATCCGAC
SDGGAAACTGAAATAGATCGAGCG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR103 bp++-
TDFTDR96 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
14808A-A7VGB6C57BL/6NTac
14808A-E11VGB6C57BL/6NTac
14808A-H9VGB6C57BL/6NTac
14808A-F4VGB6C57BL/6NTac
14808A-H5VGB6C57BL/6NTac
14808A-G8VGB6C57BL/6NTac